JFS Abstract Details


Title Antiobesity Effects of Undaria Lipid Capsules Prepared with Scallop Phospholipids
Abstract Journal of Food Science Antiobesity Effects of Undaria Lipid Capsules Prepared with Scallop Phospholipids H: HEALTH, NUTRITION, AND FOOD antiobesity effect capsule fucoxanthin n-3 polyunsaturated fatty acid UCP1 Introduction Approximately 30000 to 40000 tons of scallop processing by-products are generated annually in Hokkaido, Japan. Among these by-products are scallop viscera, which contain elevated levels of heavy metals and are considered to be a severe environmental hazard. Scallop viscera contain a high concentration of organic compounds such as proteins and phospholipids (PLs). PLs derived from scallop have high levels of long-chain n-3 polyunsaturated fatty acids (n-3 PUFAs) such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). These fatty acids have been shown in numerous research studies to be of nutritional importance in the diets of both animal and human subjects. Consumption of EPA and DHA are linked to several physiological benefits, including improvement of lipid metabolism, prevention of coronary heart diseases, and reduction of inflammatory responses (Taha and others 2009; Baik and others 2010; Chen and Shih 2010). In addition, these fatty acids have been shown to reduce adiposity in animals fed a high-fat diet by limiting hypertrophy and hyperplasia of fat cells (Ruzickova and others 2004). An in vitro study also revealed that DHA causes fat reduction by reducing preadipocyte differentiation, inducing apoptosis, and promoting adipocyte delipidation (Kim and others 2006). Similarly to these bioactive fatty acids, our previous studies clearly demonstrated that consumption of Undaria pinnatifida lipids (ULs) is associated with improved lipid metabolism. It is now evident that ULs exhibit a substantial antiobesity function both in vivo and in vitro, and our ongoing studies clearly indicate that fucoxanthin and/or its metabolites are active antiobesity agents in ULs (Maeda and others 2006). Capsules, usually refers to nanocapsules or microcapsules, are submicroscopic colloidal bioactive agent carrier systems composed of either a lipid-rich or an aqueous core surrounded by a thin polymer membrane. Owing to the presence of both lipid and aqueous phases, these capsules can be utilized in the entrapment, delivery, and release of both water-soluble and lipid-soluble material (Mozafari and others 2008). PLs such as soy lecithin have been the most utilized component for capsule formation in both food and drug delivery systems. In the current study, PLs derived from scallop by-products were used in the place of soy lecithin to produce capsules. Given that both fucoxanthin and n-3 PUFA exhibit encouraging antiobesity activity, incorporation of ULs into n-3 PUFA-rich PLs could enhance the physiological benefits on lipid metabolism. Therefore, the aim of this investigation was 1st to develop a novel encapsulation technique utilizing scallop-derived PLs with subsequent incorporation of ULs, and 2nd to evaluate the antiobesity effect of these bioactive lipids in an encapsulated form. Materials and Methods UL and PL preparation Wakame seaweed (U. pinnatifida) powder was purchased from Riken Vitamin (Tokyo, Japan), and the lipophilic fraction was extracted by ethanol. The solvent-seaweed mixture was held overnight at room temperature, and then the mixture was subjected to filtration to remove any particles remaining in the solution. The resulting ULs–ethanol solution was kept at –20 °C until further use. PLs derived from the scallop midgut gland was supplied by Cosmo Foods (Hokkaido, Japan) and kept at –20 °C until use. Animal care This study was conducted with 3-wk-old male KK-Ay mice purchased from CREA Japan (Tokyo, Japan). All procedures for the use and care of animals for this study were approved by the Ethical Committee of Experimental Animal Care at Hokkaido Univ.ersity. Mice were individually housed in plastic cages at a constant humidity (55%) and temperature (23 ± 1 °C), with a 12-h light/dark cycle throughout the experiment and free access to drinking water or the experimental drink. After a 1-wk acclimatization period with control diets, the mice were randomly divided into 7 groups of 7 mice each and fed either the experimental drink or diet for 4 wk. The mice receiving the experimental drink continued to receive the control diet. The body weight (BW) of each mouse was recorded daily, as well as food and drinks/water intake. At the end of the experimental period (4 wk), the rats were fasted for 12 h, and blood samples were taken under inhalation anesthesia (diethyl ether) by cardiac puncture. The weight of organs and white adipose tissue (WAT) were determined and expressed as g/100 g BW. Diet and drink preparation Experimental diets were prepared according to the recommendations of the American Institute of Nutrition (AIN-93G). Sucrose and L-cystine were purchased from Kanto Chemical Co., Inc. (Tokyo, Japan), choline bitartrate and tert-Butylhydroquinone were obtained from Sigma-Aldrich (Tokyo, Japan) and the remaining ingredients were purchased from CREA Co. The composition of the experimental diets and drinks remained the same for all groups, with the only variable being the type of lipid (UL and/or PLs) (Table 1). 1– Concentration of Undaria lipid (UL) and scallop midgut gland phospholipid (PL) in the experimental drinks or diets. Drinks Diets 0.2% UL 0.3% PL 0.2% UL + 0.3% PL 1% UL 1% PL 1% UL + 1% PL Diet (wt %) Soybean oil 13.51 13.51 13.51 12.51 12.51 11.51 UL 0 0 0 1.00 0 1.00 Scallop midgut gland PL 0 0 0 0 1.00 1.00 Drink (wt/v, %) UL 0.20 0 0.20 0 0 0 Scallop midgut gland PL 0 0.30 0.30 0 0 0 In order to prepare capsules containing ULs incorporated in scallop PLs, an UL emulsion was prepared. The ethanol was completely removed from the UL—ethanol solution described previously by a vacuum pump in order to generate a thin layer of UL film on the bottom of the sample vials. Next, water was added to the bottle at the ratio of 50 volumes water to 1 volume UL. The UL-water solution was sonicated by a chip-type sonicater to create the UL emulsion. This emulsion was further diluted with water to a UL concentration of 0.2% and was fed to an experimental drink feeding group (0.2% UL, Table 1). PL obtained from Cosmo Foods was dissolved in water to a final concentration of 0.3% and fed to a second experimental drink feeding group (0.3% PL, Table 1). An additional experimental drink feeding group (0.2% UL + 0.3% PL) received a combination of 0.2% UL and 0.3% PL emulsions. For the capsule feeding groups, an UL emulsion was first prepared by sonication as described above, and then PLs were dissolved in the emulsion at the ratio of one volume UL emulsion to 1.5 volumes PLs. The mixture was then sent to Cosmo Foods under refrigeration for preparation of the UL-incorporated capsules. The size distribution of the prepared capsules is depicted in Figure 1. The average size of the particles in the capsules was 121.0 nm, ranging from 38.7 nm (1.2% frequency) to 296.2 nm (1.5% frequency), with a median of 111.7 nm (Dynamic Light Scattering Nano-Particle Size Analyzer LB-550, HOLIBA, Tokyo, Japan). All concentrated experimental drinks were prepared once a week and then diluted daily prior to feeding. The control group, as well as all experimental drink feeding groups, was fed a control diet prepared according to AIN-93G. In 2 of the experimental food diets, the amount of soybean oil was reduced to 12.5% and the experimental lipid portion of the diet (either UL or PL) was incorporated at 1%. These groups are referred to as 1% UL and 1% PL (Table 1). In a 3rd experimental feeding group, the amount of soybean oil was reduced to 11.5%, and the UL and PL experimental portions were both incorporated at 1% (Table 1). All feeds were vacuum-packed immediately after preparation and stored at –70°C. All experimental diet feeding groups received free access to drinking water. 1– Size distribution of undaria lipid capsules prepared with scallop phospholipids. Determination of plasma lipid profile At the time of dissection, blood samples were collected immediately and centrifuged (High-Speed Micro Centrifuge, HITACHI, Tokyo, Japan) at 1400×g for 10 min. The samples were brought to the Hakodate Medical Association Inspection Center for plasma lipid composition analysis. The analysis included measurement of the following parameters: cholesterol (total, high density lipoprotein [HDL] and low density lipoprotein [LDL]), triacylglycerols (TG), PLs, and free fatty acid (FFA) levels. mRNA analysis The abdominal epididymal adipose tissues were dissected, washed with cold saline solution, and weighed. A portion of these tissues was kept in RNA Later Storage Solution (Sigma Chemical Co., St. Louis, Mo., U.S.A.) at –20 °C in order to use for determination of Uncoupling protein 1 (UCP1) mRNA expression. Total RNA was extracted from RNA later-treated samples (>100 mg) using the RNeasy Lipid Tissue Mini Kit (Qiagen, Tokyo, Japan). cDNA was synthesized from total RNA utilizing the high-capacity cDNA archive kit (Applied Biosystems Japan Ltd., Tokyo, Japan). The PCR solution was prepared by adding Syber Green PCR Master Mix solution (25 µL, Applied Biosystems), multiscribe reverse transcriptase (50 U/µL), RNase inhibitor (20 U/µL), template RNA, each primer at 200 nM, and RNase-free water. PCR primers, UCP1, and an internal control, mouse glyceraldehydes-3-phosphate dehydrogenase (GAPDH), were purchased from Applied Biosystems (Japan Ltd.). The primer sequences used for detection of UCP1 and GAPDH (internal control) were as follows. Forward: 50CTCAGGATTGGCCTCTACGACTC30 and reverse: 50TTGGTGTACATGGACATCGCA30, for UCP1; and forward: 50GAAGGTCGGTGTGAACGGATT30 and reverse: 50GAAGACACCAGTAGACTCCACGACATA30 for GAPDH. Real-time quantitative RT-PCR analysis was applied in an automated sequence detection system (7500-Real Time PCR System; Applied Biosystems Japan Ltd.). PCR temperature cycling conditions were 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Western blotting analysis After the dissection, epididymal WAT from each treatment was rapidly frozen with liquid nitrogen and stored at –70 °C for western blotting analysis. Each WAT (ca. 500 mg) was homogenized by RNase-Free Disposable Pellet Pestles (Thermo Fisher Scientific Inc., Waltham, Mass., U.S.A.) in 250 mL buffer solution containing 10 mM Tris-HCl and 1 mM EDTA (pH 7.4) for 30 s with a Polytron (Thermo Fisher Scientific Inc.). The mixture was then centrifuged at 1500 g for 5 min, and the lower layer, containing soluble proteins, was obtained as fat-free extract. Total protein content in the extract was determined with a DC protein assay kit (Bio-Rad, Tokyo, Japan). Each sample solution was electrophoresed using 10% sodium dodecyl sulfate-polyacrylamide gel and approximately 40 mg of protein per lane. Following electrophoresis, the gels were transferred into buffer (25 mM Tris, 5% MeOH), and the proteins were subsequently blotted onto a polyvinylidene fluoride membrane (AE-6677 ATTO, Tokyo, Japan). After washing with phosphate buffer saline (PBS)-Tween (PBS with 0.1% Tween 20), the primary antibody (UCP1; Sigma, St. Louis, Mo., U.S.A.; diluted 1:1000) was applied for 1 h at room temperature). After 5 washes with PBS-Tween and 4 washes with BLOTTO, a secondary antibody (rabbit IgG-conjugated horseradish peroxidase; Santa Cruz Biotechnology, Santa Cruz, Calif., U.S.A; diluted 1:2000 in BLOTTO) was applied for an additional hour at room temperature. After another 5 washes with PBS-Tween followed by 4 washes with BLOTTO, UCP1 was detected using a chemiluminescence detection kit (ECL system, Amersham Pharmacia Biotech, Piscataway, N.J., U.S.A.) following the manufacturer's recommendations. The expression of ß-actin was also detected as an internal control using a ß-actin antibody (Santa Cruz Biotechnology). Statistical analysis The results were expressed as mean ± standard deviation (SD). Statistical comparisons were made between treatments using ANOVA and Duncan's post hoc multiple range test using SPSS software (SPSS Inc., Chicago, Ill., U.S.A.). The results were presented in terms of P values, where a significant difference was defined as P < 0.05. Results and Discussion Changes in BW Figure 2 illustrates the changes in BW recorded daily during the experimental period. The experimental drink groups that received either 0.2% UL or the capsules (0.2% UL + 0.3% PL) exhibited significant reductions in BW during the experimental period, beginning at 15 d. These results indicate that the experimental drinks containing UL alone or with PL likely possess a certain degree of antiobesity activity. For the groups fed experimental diets, there were no significant differences in BW. 2– Changes in body weight of KK-Ay mice during the experimental period for (A) experimental drinks and (B) experimental diets. KK-Ay mice received either the 0.2%Undaria lipid (UL) drink (?), 0.3% scallop midgut gland phospholipid (PL) drink (?), 0.2% UL + 0.3% PL drink (•), 1% UL diet (?), 1% PL diet (?), 1% UL + 1% PL diet (?) or the control diet (?). Groups that exhibited significant differences (at 4 wk) are listed to the right of each graph, with a different superscript letter representing a significant difference (P < 0.05). Changes in organ and adipose tissue weights At the time of dissection, WAT (mesenteric, epididymal, and perirenal) from mice in each treatment group were collected and the weights were recorded in terms of g/100 g BW (Figure 3). As shown in Figure 3(A), the mesenteric WAT weight was reduced in all experimental groups as compared to the control group. This reduction was significantly different (P < 0.05) from the control group for mice receiving the capsule drink (0.2% UL + 0.3% PL; 4.45 ± 0.73 g/100 g BW), 1% UL diet (4.43 ± 0.27 g/100 g BW), and 1% UL + 1% PL diet (4.37 ± 0.53 g/100 g BW). Total WAT is composed of perirenal WAT, retroperitoneal WAT, mesenteric WAT, epididymal WAT, and gluteal WAT and is expressed as g/100g BW in Figure 3B. Only the capsule drink group (9.02 ± 1.23 g/100 g BW) exhibited a significant weight reduction compared to the control group (10.1 ± 0.41 g/100 g BW). Adipose tissue has long been misconstrued as simply a site for fat storage; however, it is now known to contain a number of metabolic and endocrine signaling compounds, such as tumor necrosis factor a, acylation-stimulating protein, and leptin. With higher amounts of adipose tissue, leptin production will be decreased, contributing to increased hunger and decreased energy expenditure, as well as hyperphagia in insulin-deficient diabetes patients (Havel 2000). Furthermore, it is now evident that there is an inverse correlation between fat mass and secretion of adiponectin. Adiponectin was recently shown to modulate a wide array of biological functions and demonstrate inflammatory effects, especially in endothelial cells and macrophages (Yang and others 2001). In our study, treatment with the capsule drink containing both UL and PL resulted in a significant reduction in adipose tissue mass. Because reduced adipose tissue mass may be linked to beneficial modulation of a number of complex metabolic and endocrine functions in fat cells, the observations in this study provide encouraging evidence toward the health-promoting effects of capsules containing UL and PL. 3– (A) Mesenteric white adipose tissue (WAT) weight and (B) total WAT weight of mice receiving 0.2%Undaria lipid (UL) drink, 0.3% scallop midgut gland phospholipid (PL) drink, 0.2% UL drink + 0.3% PL drink, 1% UL diet, 1% PL diet, 1% UL + 1% PL diet, and the control diet. Columns with different superscript letters indicate a significant difference between treatment groups (P < 0.05). Serum lipid profiles The 0.2% UL drink group, 1% UL diet group, and 1% UL + 1% PL diet group exhibited higher concentrations of total cholesterol, HDL-cholesterols, and PLs (Table 2). These results are in agreement with our previous study, which showed that incorporating UL into the diet leads to increased concentrations of these serum lipids (data not shown). On the other hand, feeding capsules containing both 0.2% UL and 0.3% PL resulted in statistically identical levels of these serum lipids (129 mg/dL of total cholesterol, 86.3 mg/dL of HDL-cholesterol, and 227mg/dL of PL compared to the control group (124 mg/dL, 75.5 mg/dL, and 228 mg/dL, respectively). There were no significant differences among groups for the other lipid parameters measured, including TG and FFA concentrations. 2– Lipid parameters in the serum of KK-Ay mice receiving experimental drinks or diets. Control Drink Diet 0.2% UL 0.3% PL 0.2% UL + 0.3% PL 1% UL 1% PL 1% UL + 1% PL Total cholesterol (mg/dL) 125 ± 14.8a 180 ± 21.4b 113 ± 24.8a 129 ± 14.3a 228 ± 35.1c 117 ± 7.96a 210 ± 30.5C HDL cholesterol (mg/dL) 75.5 ± 10.8a 102 ± 10.7b,c 76.9 ± 18.0a 86.3 ± 9.83a,b 110 ± 14.4C 78.3 ± 7.45a 109 ± 31.7C LDL cholesterol (mg/dL) 12.0 ± 0.63a,b,c 15.1 ± 2.73c,d 10.4 ± 2.51a,b 10.7 ± 1.38a,b 15.7 ± 5.13d 9.14 ± 1.21a 13.4 ± 3.69b,c,d Triacylglycerols (mg/dL) 135 ± 39.4a 170 ± 54.6a 134 ± 49.0a 121 ± 26.1a 146 ± 64.8a 161 ± 66.7a 138 ± 41.0a Phospholipids (mg/dL) 228 ± 28.9a 298 ± 23.2b 204 ± 37.7a 227 ± 26.8a 322 ± 43.0b 209 ± 11.6a 299 ± 31.1b FFA(/xEq/L) 1276 ± 358a 1494 ± 282a 1280 ± 273a 1335 ± 256a 1318 ± 309a 1261 ± 156a 1197 ± 219a a,b,c,dDifferent superscript letters in the same row indicate a significant difference among treatment groups (P < 0.05). Expression of UCP1 and UCP1 mRNA in epididymal WAT Western blotting analysis was carried out to elucidate the relationship between UCP1 gene expression and lipid levels in the experimental groups. UCP1 is generally only expressed in brown adipose tissue (BAT), but can be expressed in other tissues such as WAT and muscle with an appropriate stimulus. The energy obtained from nutrients can either be dissipated as heat via UCP1 or used for adenosine triphosphate (ATP) synthesis by the enzyme ATP synthase (Bray and Tartaglia 2000). For this reason, upregulation of UCP1 expressions in adipose tissues is linked to reductions in adipose tissue mass, leading to an encouraging antiobesity effect. The previous studies in our laboratory demonstrated that feeding mice UL with fucoxanthin resulted in increased levels of both UCP1 expression and UCP1 mRNA expression in WAT, along with significant reductions in BW and total WAT weight. This report was the first to discover that upregulation of UCP1 expression can be initiated in WAT, not only in BAT, as a result of intake of a specific food component, fucoxanthin, which is a carotenoid from edible brown seaweed (Maeda and others 2005). Previously, 2.0% UL was incorporated into the diet, whereas in the present study 1.0% UL was incorporated into the diet and 0.2% UL was mixed into a drink form. The percentages were changed in this study in order to determine the lowest concentration of UL required to exhibit a significant antiobesity effect. This study demonstrated that diets containing 1% UL did not show significant antiobesity effects, probably due to the low concentration of fucoxanthin mixed in the diet (Figure 4 and 5). However, the group receiving UL + PL capsules demonstrated a significantly higher level of UCP1 expression (2.15 times higher than that of control group), even though the percentage of both UL (0.2%) and PL (0.3%) in the drink were very low (Figure 4). In order to determine the mRNA expression levels of UCP1, RT-PCR analysis was carried out for epididymal WAT (Figure 5). Although both the groups receiving 0.2% UL and the capsule group exhibited higher UCP1 mRNA expression levels than the control, these levels were significantly different only in the case of the capsule group (4.23 times higher than that of control group). These results suggest that UL and PL work in an additive manner to reduce obesity, resulting in a greater antiobesity effect than that which would be expected at these reduced concentrations. 4– Western blotting analysis of uncoupling protein 1 (UCP1) in epididymal WAT and relative expression level of UCP1 protein compared to ß-actin. Columns with different superscript letters are significantly different (P < 0.05). 5– UCP1 mRNA expression levels in epididymal WAT. Expression of UCP1 mRNA was estimated by quantitative real-time polymerase chain reaction. Relative values were presented as the ratio of UCP1 mRNA to GAPDH mRNA. Conclusions In this study, a lipid delivery system was developed and tested for its antiobesity effect in KK-Ay mice. Significant reductions in BW and fat mass were observed in a diabetic-obese mice model by administering capsules containing bioactive lipids. The combination of UL and PL was found to result in an additive effect, as compared to administrating either lipid alone. The observed reduction in BW was likely due to the increases in the expression of UCP1 and UCP1 mRNA found in epididymal fat tissue. A better understanding of the precise mechanisms of weight reduction through UCP1 expression will likely lead to new approaches for managing obesity. In addition to the lipids utilized in this study, any hydrophilic compounds with antiobesity effects could be incorporated into the capsule delivery system developed here, leading to numerous potential applications. This study has shown that various bioactive agents can be utilized with combinative applications in order to increase energy expenditure and help to reduce BW and fat mass. Acknowledgment This work was partly supported by a Regional Research and Development Consortium Project (April 2006 to March 2008) “Development of Functional Food Material by Micro-Capsulation of Agriculture and Fisheries Products,” Ministry of Economy, Trade and Industry (METI), Japan. This was also partly supported by a National Project “Knowledge Cluster Initiative” (2nd stage, “Sapporo Biocluster Bio-S” and “Hakodate Marine Bio Industrial Cluster–Green Innovation of UMI”), Ministry of Education, Culture, Sports, Science and Tecnology (MEXT, Japan).
Article Date January/February 2011
Issue 1
Volume 76
Key Issues